Plasmid_Backbone
Part:BBa_J61002:Design
Designed by: John Anderson Group: Arkin Lab (2006-07-31)
EX-Ptet-S-rbsRFP-P "RFP reporter"
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2927
Illegal XbaI site found at 2942
Illegal SpeI site found at 2
Illegal PstI site found at 885 - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2927
Illegal SpeI site found at 2
Illegal PstI site found at 885
Illegal NotI site found at 878
Illegal NotI site found at 2933 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2927 - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2927
Illegal XbaI site found at 2942
Illegal SpeI site found at 2
Illegal PstI site found at 885 - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2927
Illegal XbaI site found at 2942
Illegal SpeI site found at 2
Illegal PstI site found at 885
Illegal AgeI site found at 581
Illegal AgeI site found at 693 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI.rc site found at 1966
Design Notes
N/A
Source
PCR ca1020F/R on pSB1A2-I13521 (900bp, SpeI/PstI)
Sub into pSB1A2-I13522 (SpeI/PstI)
Product is pBca1020, will be an iGEM number ultimately
ca1020F Forward SpeI oligo for X-rbsRFP-P plasmid
gcactACTAGTgaaagaggagaaatactagatggc
ca1020R Reverse PstI oligo for X-rbsRFP-P plasmid
ccggactgcagcggccgcttctagtatataaacg